Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bos taurus (cattle) microRNA bta-mir-375 precursor secondary structure diagram

Bos taurus (cattle) microRNA bta-mir-375 precursor URS000075BCF9_9913

Automated summary: This pre miRNA sequence is 64 nucleotides long and is found in Bos taurus. Annotated by 3 databases (ENA, RefSeq, miRBase). Described in 9 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-375, RF00700). Bos taurus (cattle) microRNA bta-mir-375 precursor sequence is a product of 375, mir-375 precursor, mir-375, MIR375, mir-375 precurso, bta-mir-375 precursor genes. Found in the cattle reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CCCCGCGACGAGCCCCUCGCACAAACCGGACCUGAGCGUUUUGUUCGUUCGGCUCGCGUGAGGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 36 other species

    1. Aotus nancymaae miRNA
    2. Carlito syrichta (Philippine tarsier) miRNA
    3. Castor canadensis microRNA 375
    4. Cavia porcellus microRNA 375
    5. Cercocebus atys (Sooty mangabey) miRNA
    6. Chinchilla lanigera (Long-tailed chinchilla) microRNA 375
    7. Colobus angolensis palliatus microRNA 375
    8. Dipodomys ordii microRNA 375 (Mir375)
    9. Fukomys damarensis (Damara mole rat) miRNA
    10. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 375
    11. Heterocephalus glaber microRNA 375
    12. Homo sapiens microRNA hsa-mir-375 precursor
    13. Ictidomys tridecemlineatus microRNA 375
    14. Macaca fascicularis (Crab-eating macaque) miRNA
    15. Macaca mulatta microRNA mml-mir-375 precursor
    16. Macaca nemestrina miRNA
    17. Mandrillus leucophaeus (Drill) miRNA
    18. Mesocricetus auratus (Golden Hamster) miRNA
    19. Microcebus murinus miRNA
    20. Microtus ochrogaster microRNA 375
    21. Mus caroli microRNA 375
    22. Mus musculus (house mouse) microRNA mmu-mir-375 precursor
    23. Mus pahari microRNA 375
    24. Mus spretus microRNA 375
    25. Nannospalax galili microRNA 375 (Mir375)
    26. Nomascus leucogenys (Northern white-cheeked gibbon) miRNA
    27. Octodon degus (Degu) microRNA 375
    28. Pan paniscus (bonobo) miRNA
    29. Panthera pardus microRNA 375
    30. Pan troglodytes (chimpanzee) ptr-mir-375
    31. Papio anubis (Olive baboon) miRNA
    32. Peromyscus maniculatus bairdii (Northern American deer mouse) microRNA 375
    33. Pongo abelii miRNA
    34. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-375 precursor
    35. Propithecus coquereli (Coquerel's sifaka) miRNA
    36. Rhinopithecus bieti miRNA
    37. Rhinopithecus roxellana microRNA 375
    38. Saimiri boliviensis boliviensis miRNA
    2D structure New