Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000008683.1) secondary structure diagram

Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000008683.1) URS000075BCF9_39432

Automated summary: This pre miRNA sequence is 64 nucleotides long and is found in Saimiri boliviensis boliviensis. Annotated by 1 database (Ensembl). Described in 1 paper. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-375, RF00700). Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000008683.1) sequence is a product of ENSSBOG00000008683.1 gene. Found in the bolivian squirrel monkey reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CCCCGCGACGAGCCCCUCGCACAAACCGGACCUGAGCGUUUUGUUCGUUCGGCUCGCGUGAGGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 72 other species

    1. Aotus nancymaae miRNA (ENSANAG00000013045.1)
    2. Bos taurus (cattle) microRNA bta-mir-375 precursor
    3. Carlito syrichta miRNA (ENSTSYG00000031312.1)
    4. Castor canadensis (American beaver) microRNA 375 (ENSCCNG00000009831.1)
    5. Cavia porcellus microRNA 375 (ENSCPOG00000019434.2)
    6. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000022225.1)
    7. Chinchilla lanigera (Long-tailed chinchilla) microRNA 375 (ENSCLAG00000021057.1)
    8. Colobus angolensis palliatus microRNA 375 (ENSCANG00000018200.1)
    9. Dipodomys ordii microRNA 375 (ENSDORG00000021622.2)
    10. Fukomys damarensis (Damara mole rat) miRNA (ENSFDAG00000002898.1)
    11. Gorilla gorilla gorilla microRNA 375 (ENSGGOG00000034335.2)
    12. Heterocephalus glaber microRNA 375 (ENSHGLG00000022298.1, ENSHGLG00100024343.1)
    13. Homo sapiens (human) microRNA hsa-mir-375 precursor
    14. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) microRNA 375 (ENSSTOG00000022445.2)
    15. Macaca fascicularis (Crab-eating macaque) miRNA
    16. Macaca mulatta microRNA mml-mir-375 precursor
    17. Macaca nemestrina miRNA (ENSMNEG00000001781.1)
    18. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000012184.1)
    19. Mesocricetus auratus miRNA (ENSMAUG00000003354.1)
    20. Microcebus murinus (gray mouse lemur) miRNA (ENSMICG00000019647.3)
    21. Microtus ochrogaster (vole) microRNA 375 (ENSMOCG00000009208.1)
    22. Mus caroli (Ryukyu mouse) microRNA 375 (MGP_CAROLIEiJ_G0006948.1)
    23. Mus musculus microRNA mmu-mir-375 precursor
    24. Mus pahari (Shrew mouse) microRNA 375 (MGP_PahariEiJ_G0007481.1)
    25. Mus spretus microRNA 375 (MGP_SPRETEiJ_G0007284.1)
    26. Nannospalax galili microRNA 375 (ENSNGAG00000008184.1)
    27. Nomascus leucogenys miRNA (ENSNLEG00000024085.2)
    28. Octodon degus (Degu) microRNA 375 (ENSODEG00000022291.1)
    29. Pan paniscus miRNA (ENSPPAG00000007146.1)
    30. Panthera pardus microRNA 375 (ENSPPRG00000014743.1)
    31. Pan troglodytes (chimpanzee) ptr-mir-375 (ENSPTRG00000027556.2)
    32. Papio anubis miRNA (ENSPANG00000026867.2)
    33. Peromyscus maniculatus bairdii microRNA 375 (ENSPEMG00000002916.2)
    34. Pongo abelii (Sumatran orangutan) miRNA
    35. Pongo pygmaeus microRNA ppy-mir-375 precursor
    36. Propithecus coquereli miRNA (ENSPCOG00000007920.1)
    37. Rhinopithecus bieti miRNA (ENSRBIG00000007800.1)
    38. Rhinopithecus roxellana microRNA 375 (ENSRROG00000002489.1)
    2D structure New