v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-6511a precursor (hsa-mir-6511a 1 to 4) secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-6511a precursor (hsa-mir-6511a 1 to 4) URS000075BCEB_9606

Automated summary: This pre miRNA sequence is 67 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (HGNC, MalaCards, GeneCards, Ensembl, ENA, RefSeq, miRBase, Rfam). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-6511, RF03340). Homo sapiens (human) microRNA hsa-mir-6511a precursor (hsa-mir-6511a 1 to 4) sequence is a product of ENSG00000276311.1, 6511 microRNA precursor family, hsa-mir-6511a-3 precursor, hsa-mir-6511a-4 precursor, mir-6511a-2, ENSG00000273613.1, mir-6511a-3 precursor, MIR6511A2, mir-6511a-4 precurso, 6511 microRNA precursor famil, ENSG00000278221.1, mir-6511a-1 precursor, hsa-mir-6511a-2 precursor, mir-6511a-4 precursor, mir-6511a-2 precurso, MIR6511A3, mir-6511a-1 precurso, mir-6511 microRNA precursor family, ENSG00000275259.1, mir-6511a-3 precurso, mir-6511a-4, MIR6511A1, mir-6511a-3, MIR6511A4, mir-6511a-1, mir-6511a-2 precursor, hsa-mir-6511a-1 precursor genes. Found in the Homo sapiens reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    CCUGCAGGCAGAAGUGGGGCUGACAGGGCAGAGGGUUGCGCCCCCUCACCAUCCCUUCUGCCUGCAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    2D structure Publications