Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4492 precursor URS000075BCE6_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR4492: MIR4492 is a microRNA gene that was investigated using RT-qPCR with TaqMan microRNA assays [PMC7000740]. However, the effects of MIR4492 could not be characterized using summary statistics alone [PMC10061723]. A risk single nucleotide polymorphism (SNP) was identified in an enhancer-like domain near MIR4492, suggesting that the regulation of this microRNA gene is influenced by other factors [PMC10061723]. Further investigation is needed to understand the impact of this enhancer SNP on MIR4492 expression in multiple sclerosis (MS) patients, particularly in the context of Epstein-Barr virus (EBV) infection [PMC10061723]. Other miRNA genes located on 11q include miR5579, miR3166, miR1261, miR4300, miR4490, miR1304, miR1260B, miR3920, miR4693, miR4491, and MIR4493. However, their functions remain unknown [PMC5492892]. One of these genes is located near MIR4492 on 11q23 and its function is also unknown [PMC5492892].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGCAGCGUGCUUCUCCAGGCCCCGCGCGCGGACAGACACACGGACAAGUCCCGCCAGGGGCUGGGCGCGCGCCAGCCGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes miRNA
Publications