v21

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Nannospalax galili (Upper Galilee mountains blind mole rat) microRNA 208b (ENSNGAG00000007992.1) URS000075BCD9_1026970

Automated summary: This pre miRNA sequence is 77 nucleotides long and is found in Nannospalax galili. Annotated by 1 database (Ensembl). Matches 1 Rfam family (mir-208, RF00749). Nannospalax galili (Upper Galilee mountains blind mole rat) microRNA 208b (ENSNGAG00000007992.1) sequence is a product of ENSNGAG00000007992.1 gene. Found in the upper galilee mountains blind mole rat reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    CCUCUCAGGGAAGCUUUUUGCUCGCGUUAUGUUUCUCAUCCGAAUAUAAGACGAACAAAAGGUUUGUCUGAGGGCUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    Publications New