Automated summary: This pre miRNA sequence is 77 nucleotides long and is found in Mus musculus. Annotated by 7 databases (miRBase, ENA, MGI, PSICQUIC, Ensembl, Rfam, RefSeq). Matches 1 Rfam family (mir-208, RF00749). Mus musculus (house mouse) microRNA mmu-mir-208b precursor sequence is a product of ENSMUSG00000077928.3, Mir208b, 208, mir-208, mir-208b, mmu-mir-208b precursor, mir-208b precursor, mir-208b precurso genes. Found in the mouse reference genome.
According to IntAct, Mus musculus (house mouse) microRNA mmu-mir-208b precursor interacts with:
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
CCUCUCAGGGAAGCUUUUUGCUCGCGUUAUGUUUCUCAUCCGAAUAUAAGACGAACAAAAGGUUUGUCUGAGGGCUG
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.