Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-545 precursor URS000075BCC5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR545: MIR545 is a pre-mir that has been linked to cell proliferation in colorectal cancer [PMC7199595]. It has been found to be upregulated in endometrial cancer [PMC7199595]. No miRNA prediction binding site tool has identified a statistically supported connection between MIR545 and GPR161 [PMC7199595]. However, it is suggested that both GPR161 and MIR545 may be involved in promoting cell proliferation in UCEC [PMC7199595]. In cervical cancer (CC), it has been found that circ_0067934 interacts with MIR545 as a sponge, inhibiting its expression level [PMC9260044]. Both MIR545 and EIF3C genes are potential gene therapy targets for CC [PMC9260044]. In Lewis Lung Carcinoma cell lines, overexpressed MIR545 inhibits Ku70 activity, suggesting its role in radioresistance [PMC4453103]. The upregulation of MIR545 is HBx-dependent [PMC9280728]. In pancreatic ductal adenocarcinoma, MIR545 directly targets RIG-I, a regulator of antiviral response [PMC6370596]. In experiments testing miRNA mimics, MIR545 was used as a negative control with no observed phenotype compared to mock transfected cells or control siRNA transfected cells [PMC7801944]. Additionally, it has been found that ESRRG is a potential target gene of miR-545/374a and its expression is inversely related to the expression of MIR545[ PMC8789654]. Overall, the research suggests that MIR545 plays important roles in cell proliferation and radioresistance in various cancers.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCCAGCCUGGCACAUUAGUAGGCCUCAGUAAAUGUUUAUUAGAUGAAUAAAUGAAUGACUCAUCAGCAAACAUUUAUUGUGUGCCUGCUAAAGUGAGCUCCACAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications