Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3937 URS000075BC71_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3937: Hsa-mir-3937 is a microRNA that has been found to be upregulated in colorectal cancer (CRC) patients compared to healthy individuals [PMC9117024]. It has been shown to bind to and downregulate the expression of the BCL2L12 gene [PMC9117024]. The expression levels of hsa-mir-3937 in CRC patients were found to be significantly increased [PMC9117024]. Exosomal hsa-mir-3937 has been identified as a potential diagnostic marker for CRC [PMC9117024]. It was found that the combination of hsa-mir-3937 with CEA and CA199 had a higher area under the curve (AUC) compared to other combinations, indicating its potential as a diagnostic biomarker for CRC [PMC9117024]. The expression levels of exosomal hsa-mir-3937 were associated with T stage, indicating its potential as a prognostic marker for CRC [PMC9117024]. Silencing hsa-mir-3937 resulted in decreased invasion and migration of CRC cells, suggesting its role in promoting tumor progression [PMC9117024]. The binding site of hsa-mir-3937 on the BCL2L12 gene was predicted using TargetScan [PMC9117024]. Exosomal hsa-mir-3937 expression levels were higher in advanced stage CRC patients' plasma samples compared to early stage patients' plasma samples [PMC9117024]. Reference: [PMC7933252]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACAGGCGGCUGUAGCAAUGGGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications