Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-147b precursor URS000075BC4D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-147b: Hsa-mir-147b is a microRNA that has been found to be associated with rectum cancer [29]. In the presence of the CHRM3 gene, bile acid is likely to induce right-sided colon tumors and decrease the expression of hsa-mir-147b [PMC10152154]. Several effective pairings of microRNAs have been identified in different countries, including hsa-mir-1267, hsa-mir-325, hsa-mir-5683, and hsa-mir-3064-5p in China; hsa-mir-5197, hsa-mir-147b, hsa-mir-6874, hsa-mir-138-1, hsa-mir-664b, and hsa-mir1-3p in India; and hasmir1267, hasmir1381, hasmir664b and hasmir13p in Italy [PMC7395633]. These microRNA pairings have been found to have interactions with viral SARS-CoV2 miRNAs [PMC7395633]. In Jamaica specifically, there are three collective pairings of microRNAs involved with viral SARS-CoV2 miRNAs: hasmir1267, hasmir325 and hasmir5683 [PMC7395633]. These findings suggest that different microRNA pairings may play a role in cancer development and viral interactions in different populations. Further research is needed to understand the specific mechanisms involved.

MIR147B: MIR147B is a microRNA that has been shown to act as a negative-feedback regulator of astrocyte-mediated inflammatory response [PMC7217197]. In a study investigating the modulation of MMP and TIMP expression, cells were transfected with mimic pre-miRNA for MIR147B and subsequently stimulated with IL-1β to mimic an inflammatory response [PMC7217197]. The overexpression of MIR147B was confirmed through Taqman PCRs, indicating successful transfection [PMC7217197]. The transfection of MIR147B was found to attenuate the IL-1β-induced upregulation of MMP3 and downregulation of TIMP2 and TIMP3 in tuber-derived cell cultures [PMC7217197]. Additionally, it has been suggested that MIR147B may indirectly reduce MMP expression by interfering with brain inflammation through targeting pro-inflammatory genes [PMC7217197]. In the context of colon cancer, the expression of MIR147B has been found to be different according to tumor location, with higher expression in left colon tumors compared to right colon tumors [PMC3985145]. Furthermore, MIR147B has been identified as a potential marker for left colon tumors in colon cancer tissue [PMC3985145]. However, it is important to note that the expression and function of MIR147B are poorly studied compared to other microRNAs [PMC5768387].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAUAAAUCUAGUGGAAACAUUUCUGCACAAACUAGAUUCUGGACACCAGUGUGCGGAAAUGCUUCUGCUACAUUUUUAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications