v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) family with sequence similarity 66 member D (FAM66D) URS000075BC0D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

FAM66D: FAM66D is a LINC RNA species that is encoded by the FAM66D locus [PMC9668877]. It has been found to be upregulated in both Crohn's disease (CD) and ulcerative colitis (UC), which are the two most common types of inflammatory bowel disease (IBD) [PMC9668877]. FAM66D has also been identified as one of the genes with a higher level of ICI score in "positive dark genes", which is significantly related to a good prognosis [PMC8212786]. It has been suggested that FAM66D is regulated by EZH2 via non-PRC2-dependent pathways [PMC8995459]. In addition, FAM66D has been found to be significantly downregulated in GA samples compared to control samples [PMC5354857]. The expression of FAM66D was also found to be significantly lower in MD-MB-231-IV2-2 cells compared to MD-MB-231-IV2-1 cells [PMC8329494]. Furthermore, FAM66D was one of the lncRNAs that were identified as having a documented and predominant role in the mTOR pathway network, being connected to four or more differentially expressed coding genes [PMC5354857]. Finally, FAM66D was one of the lncRNA genes that showed increasing signal intensity based on averaged gene expression levels across different clinical subgroups, from control to iCD and iUC [PMC4437449].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AUGCGCGGUCUGCCUCCCGCGGCGGGCCGGGUCUCCAGGGAGGACCUGAGUUUUCUUCACCCAUUGUCAGGGAGGCGCCAUCGCCCUGGCUUUGGGGCUGGGGCCUCCGGGGAGGUUCCGGUAGGGGCGUUGGAGAGGCCGCUCUUUUUGCAAGGCCCGAGACGGCGGGCCUUGCGCAGGCCGCCCUAUUCCGCGCCCUCAGGGCGUCAGUAUCAGCCUGAGGCUGGAUACCCCCGCUGGGCCCAGAUGCCCCCGCUGGGCCCGGAGCAUCCUCCGGCGCUGCCCUCCCAGAGCCACGCAGAGGCUGAGGUGGCGCGGGGGCGGCCCUGGCUCCGCGAGAAGCGGCGGCAGCGAGGGCUGGAGGACCCGGGCUGCGGGGCUCCGGGGCGUCUGGCCUGGGUGGGACUGAGCCCAUCCAGGGACUGGGACUCCGGGGUUCUGGUGUAGGUGGAUCCGGGGCAGGCUCAGGACCAAGUCCCUCUCCUUCCACCAAGGAGCGCCCAGAGGCCGGCGGGAGCUCCAGGUUCACCUCCUCCUCCUCCAGGAAAUCCCACUUCCAACUGGAUGUCUGGAUGAACUACUGAAAGCUGCUGAGUGUCCUGCAGCAGGCCAUUUCCAAUCCAGCGGAAGACCUUCUAGAAGAGAUGAUGGUGGGAGAGUGCUGACAUACUAUGUGAAGCUACUAUUUGGAGUUGGACACGAGUGCAUGUGUCCUUGUGCCACAACGGGAAUCUUGACUACAACACAAAUGAAUCCACUCAAAUGUUGGCAAGUGGAGCAGAGUCCCAGAACAGUCUGCAAUCUCUACAGGUACAGAAACACCCCCAGUUCAAGGAUCUUCACACCUGGAUUUAGGCCUACUCCUGCAACUACCCCAGGCACCAAUUUGAUCUUCUACUACUUUGCAGACAUCUCUUCUGCAAACACCAGACAAAUUGAGACAAUGACCUUCCACAGGACCCAAAUCACCUCUUACUGCAGGAAAGAAGAUCCAGUGAGAAAAUUAGUCCACAAAUGGAAUGUAAAUCCAUAAACACUCUUAAGUAACAGAAUAAAUUUAGUAUGAACGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications