Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-6844 precursor URS000075BC03_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-6844: Hsa-mir-6844 is a significant miRNA that is associated with the ORF1ab gene [PMC8215323]. It has been found to be related to ORF1AB, which is well-known to be associated with NSP12 [Yoshimoto 2020]. In a study conducted in Indonesia, all samples were predicted to contain hsa-mir-6844 [PMC8215323]. In addition, hsa-mir-6844, along with hsa-miR-627-5p and hsa-miR-3674, were consistently predicted in both sample groups, despite slight differences in proportion [PMC8215323]. Gene Ontology analysis revealed that hsa-miR-4778-5p, hsa-miR-4531, and hsa-mir-6844 play significant roles in four biological processes [PMC8215323]. Furthermore, hsa-mir-6844 was identified as an independent prognostic risk factor along with other miRNAs such as hsa-miR-21-3p and hsa-miR-340-5p [PMC9389359]. Among these miRNAs, the prognostic effect of hsa-mir 6844 was found to be more significant (P<0.01) [PMC9389359].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAACUUAAGAAUUUUGUAGAAAUCAAGCUAUUUGCUAAAAGUUCUUUGUUUUUAAUUCACAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Publications