Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4267 precursor URS000075BBA2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4267: Hsa-mir-4267 is a microRNA that is upregulated and potentially involved in the suppression of target genes [PMC9781133]. It is also associated with gliogenesis [PMC9781133]. Although there is no experimental evidence of its functions, hsa-mir-4267 has a predicted seed sequence in a specific region [PMC5613348]. Hsa-mir-4267 has been found to target genes such as DNAH3 and GOLGB1, and it is one of the miRNAs with higher context++ scores compared to others [PMC7766228] [PMC7249963]. It has also been identified as one of the potential targets of ELMO1-AS1, along with hsa-miR-5096 and hsa-miR-4691-5p [PMC6689543]. In the context of hepatocellular carcinoma (HCC) development, hsa-mir-4267 is co-expressed with several other miRNAs, suggesting its involvement in HCC progression [PMC9820840]. In terms of evolutionary analysis, hsa-mir-4267 shows mismatches in the chimpanzee lineage, indicating potential evolutionary changes in this microRNA sequence [PMC4966751]. References: [PMC9781133] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9781133/ [PMC5613348] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5613348/ [PMC7766228] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7766228/ [PMC7249963] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7249963/ [PCM6689543] - https://www.ncbi.nlm.nih.gov/pmc/articles/PCM6689543/ [PCM9820840] - https://www.ncbi.nlm.nih.gov/pmc/articles/PCM9820840/ [PCM4966751] - https://www.ncbi.nlm.nih.gov/pmc/articles/PCM4966751/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUCAGCAGGCUCCAGCUCGGUGGCACUGGGGGAAGGCUCCAGACCCCAGCCUCUGUCAUCCCUGCAUGGAGCCCACAUCUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications