v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) Bta-Mir-499_3p* (star (passenger)) URS000075BB59_9913

  • 22 nucleotides
  • 1 database (MirGeneDB)
  • Found in 12 other species
  • miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AACAUCACAGCAAGUCUGUGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Cavia porcellus cpo-miR-499-3p
  2. Dasypus novemcinctus (nine-banded armadillo) dno-miR-499-3p
  3. Equus caballus (horse) eca-miR-499-3p
  4. Homo sapiens hsa-miR-499a-3p
  5. Macaca mulatta mml-miR-499-3p
  6. Mus musculus Mus_musculus piRNA piR-mmu-49801062
  7. Oryctolagus cuniculus (rabbit) ocu-miR-499-3p
  8. Pan troglodytes ptr-miR-499
  9. Pongo pygmaeus (Bornean orangutan) ppy-miR-499-3p
  10. Pteropus alecto (black flying fox) pal-miR-499a-3p
  11. Rattus norvegicus (Norway rat) rno-miR-499-3p
  12. Sus scrofa (pig) ssc-miR-499-3p