Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4530 precursor URS000075BB21_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4530: Hsa-mir-4530 is one of the miRNAs that have been found to be related to EV71 infection for the first time [PMC4416288]. It is one of the eight miRNAs that were significantly up-regulated in response to EV71 infection [PMC4416288]. Additionally, hsa-mir-4530 has been identified as one of the differentially expressed miRNAs between leiomyoma and myometrium, with its expression being down-regulated in leiomyoma [PMC9154092]. Hsa-mir-4530 has also been reported to be involved in regulating inflammatory response [PMC9039132]. However, there is no evidence in the provided context to support the claim that hsa-mir-4530 regulates cancer-related target genes [PMC8240180]. Overall, hsa-mir-4530 has been implicated in various biological processes and diseases such as EV71 infection, leiomyoma development, and inflammatory response regulation [PMC4416288][PMC9154092][PMC9039132].

MIR4530: MIR4530 is a microRNA that has been studied in the context of pancreatic cancer and normal-like subtypes. In a study assessing the expression levels and diagnostic performance of miR-125a-3p, MIR4530, and miR-92a-2-5p in plasma samples from pancreatic cancer patients and noncancerous controls, MIR4530 was included as part of a panel [PMC9569215]. The study found that MIR4530, along with miR-125a-3p and miR-92a-2-5p, could potentially be used as diagnostic markers for pancreatic cancer. Additionally, it was discovered that MIR4530 is regulated by H3K4me3 at the promoter level and may have a protective role in normal-like subtypes [PMC8261273]. In normal-like cell line MCF10A, MIR4530 was found to play a role in suppressing cell proliferation, promoting angiogenesis, and inducing apoptosis by targeting the gene VASH1 [PMC8261273]. However, in another study focusing on patients with amyotrophic lateral sclerosis (ALS), including both familial (fALS) and sporadic (sALS) cases, it was found that MIR4530 was not differentially expressed [PMC6416171]. In fALS patients specifically, four microRNAs including MIR4530 were downregulated [PMC6416171]. However, in sALS patients as well as sporadic cases of ALS overall, the expression levels of these microRNAs were not significantly altered except for downregulated miR1234-3p and miR1825 [PMC9100918].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGACCGCACCCGCCCGAAGCUGGGUCAAGGAGCCCAGCAGGACGGGAGCGCGGCGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications