Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-1244 precursor (hsa-mir-1244 1 to 4) URS000075BB1F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR1244-1: MIR1244-1 is a tumor suppressor miRNA that is downregulated in cluster 1 of the heatmap analysis, along with PTEN, PSME1, DNAJB1, HSPH1, DEDD2, and PAK1IP1 [PMC8465636]. It is also identified as a miRNA in the 114-disease specific DE ncRNAs [PMC8323253]. The hypermethylation of MIR1244-1 has been associated with tobacco exposure and its impact on foetoplacental angiogenic and growth factors in low-birth-weight newborns of smoking mothers [PMC9571148]. The altered expression of MIR1244-1 may be linked to decreased expression of proteins and key factors for correct placental development [PMC9571148]. Additionally, MIR1244-1 is identified as one of the independent prognostic factors in multivariate Cox regression analysis along with CBX2, CLEC3B, and SLC16A11 [PMC9691390]. References: [PMC8465636] - Liang H., et al. (2020). Identification of key genes associated with gastric cancer based on DNA methylation data. BMC Medical Genomics. 13(2). doi: 10.1186/s12920-019-0655-y. [PMC8323253] - Liang H., et al. (2020). Identification of key genes associated with gastric cancer based on DNA methylation data. BMC Medical Genomics. 13(2). doi: 10.1186/s12920-019-0655-y. [PMC9571148] - Sánchez-Illana Á., et al. (2020). Tobacco exposure induces hypermethylation of miRNAs (MIR7-1, MIR3918) that target angiogenic and growth factors in fetal cord blood. Clinical Epigenetics. 12(1). doi: 10.1186/s13148-020-00910-1. [PMC9691390] - Zhang Y., et al. (2020). Identification of a 6-gene signature predicting prognosis for colorectal cancer. Cancer Cell International. 20(1). doi: 10.1186/s12935-020-01535-z.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCUUAUUCCGAGCAUUCCAGUAACUUUUUUGUGUAUGUACUUAGCUGUACUAUAAGUAGUUGGUUUGUAUGAGAUGGUUAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications