Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-193b precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-193b precursor URS000075BAEB_9606

  • 83 nucleotides
  • 8 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq)
  • Found in 28 species

Automated summary: This pre miRNA sequence is 83 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (ENA, HGNC, Ensembl/GENCODE, miRBase, Ensembl, GeneCards, MalaCards, RefSeq). Described in 49 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-193, RF01895). Homo sapiens (human) microRNA hsa-mir-193b precursor sequence is a product of mir-193b precurso, ENSG00000207639.1, hsa-mir-193b precursor, mir-193b precursor, mir-193b, MIR193B genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GUGGUCUCAGAAUCGGGGUUUUGAGGGCGAGAUGAGUUUAUGUUUUAUCCAACUGGCCCUCAAAGUCCCGCUUUUGGGGUCAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 27 other species

    2D structure New