v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) SAMD12 antisense RNA 1 (SAMD12-AS1) URS000075BAE3_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SAMD12-AS1: SAMD12-AS1 is a long non-coding RNA (lncRNA) that has been studied in hepatocellular carcinoma (HCC) cells [PMC8636595]. Upregulation of SAMD12-AS1 in HCC cells has been found to reduce the stability of the tumor suppressor protein p53 through the NPM1-HDM2-p53 axis, leading to alterations in cell proliferation and apoptosis [PMC8636595]. In a clonogenic assay, knockdown of SAMD12-AS1 significantly inhibited colony formation in HCC cells compared to the control group [PMC9427251]. This suggests that SAMD12-AS1 plays a role in promoting colony formation and potentially tumor growth [PMC9427251]. Furthermore, qRT-PCR data showed that SAMD12-AS1 was upregulated in HepG2-4D14 cells compared to HepG2 cells, which is consistent with RNA sequencing data [PMC6691116]. This indicates that SAMD12-AS1 expression is increased in a specific HCC cell line [PMC6691116]. Overall, these findings suggest that SAMD12-AS1 may have an oncogenic role in HCC by affecting p53 stability and promoting colony formation. Further research is needed to fully understand the mechanisms by which SAMD12-AS1 influences HCC progression and its potential as a therapeutic target.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGUUUGUGUUCCAAGGUAAGAUAACCUGAAAUGAAAAACUCAGGAUCCCUCACGAACAGCCUGACCCUGCUUUCAACCAGGAAGUUCAAGGGAGGCAGGACUUUACGGUCAAAACUGCAAAGCCGAAGCUCAAGACUGUAAGAAGAAAGUGAUCUUCAAAGAAAAGGAUUCACCCAAAUCGAAGAGGAUAUCGUUUCGCAUCAGGGACACUCGUCUCCACACCUCCUACCUCAAAGUCCUACGCACCUACCCUUCACGUCUCUCCAAAGCAACUGAAUUAAAGCGCCUACUGGCCUUGGCGGCGCAGGUCCCAAGAUUUUGACUGAUUGGUUGUACGACUAGAGUUGCUGGAGUUCAAGUAUUUUCAUUUUAACUAUUCAACUGAAAGCAGUGCGUUACAACAGAACACGGGUUCCAAAGAAUUUACUGAGAAGAAGCAAAGUAAUACUUGGGAGAACUAUAAUACACAGGCAUCUCAUGAAAAUCAUCCAACAUAUAGAAGAAUAUAUAGAAUAAAGCAAAAAUCAUCAGAAACUCCACCGUCUUGGAUGACCAUAGUUGAUAUUCUGAAUGGCUUCUGUUCCGAUUGAACCUUGACUGAUGUAGCACCUAUCACCAAAUUGCUGUUCAGGAAAUAUGUCCUAAAGAAACUCCCAACAGCAGCAAUACAUCAGAGUGGCACCUCUUUACACUGGUUCUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications