Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-6124 precursor URS000075BAD8_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-6124: Hsa-mir-6124 is a miRNA that has been identified as both up-regulated and down-regulated in various studies [PMC6717396] [PMC5073958]. It has been found to be consistently up-regulated in As4S4-treated cells compared to untreated cells [PMC6717396]. Hsa-mir-6124 is also known as hsa-mir-6124 (GGGAAAAGGAAGGGGGAGGA) and has been added to mirBase [PMC4134228]. In the context of cancer, hsa-mir-6124 has been found to be expressed in both early-stage and late-stage gastric cancer tissues [PMC5073958]. It is also associated with the risk of cardiovascular diseases, along with other miRNAs such as hsa-mir-4329 and hsa-mir-3685 [PMC9967176]. Hsa-mir-6124 is unique among miRNAs as it contains only purine bases [PMC6028587]. It is part of a circRNA–miRNA–mRNA network that includes other circRNAs, miRNAs, and mRNAs [PMC9523487]. However, the specific role of hsa-miR-6127 and hsa-mir-6124 in cigarette smoking-related pathology remains unknown [PMC8882369]. Hsa-miR-6124 is one of the key miRNAs involved in a miRNA–mRNA regulatory network associated with differential gene expression [PMC9532133].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGGAGGUAGGGAAAAGGAAGGGGGAGGAGAAGGUGAGACCAAUGUCCUGGGUGCCACUCCUGCCCAGUGCCUCCCUUCCUCGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Publications