Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-548ba URS000075BACB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-548ba: Hsa-mir-548ba is a member of the hsa-mir-548 family and is highly expressed in ovarian follicular somatic cells [PMC8501715]. In a study examining the extracellular profile of ovarian cell-depleted follicular fluid (FF), it was found that seven family members, including hsa-mir-548ba, were detected in the samples [PMC8501715]. However, when comparing the expression levels of miRNAs in cellular samples and FF, it was observed that hsa-miR-548k, hsa-mir-548ba, and hsa-miR-548i were expressed at high levels in cellular samples but were not detected in FF [PMC8501715]. This suggests that these miRNAs may have specific roles or functions within the cellular context and may not be present or released into extracellular fluids like FF [PMC8501715]. Further research is needed to understand the exact functions and mechanisms of action of hsa-mir-548ba and other members of the hsa-mir-548 family in ovarian follicular somatic cells [PMC8501715].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAGGUAACUGUGAUUUUUGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications