Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-92b precursor URS000075BA3A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR92B: MIR92B is a microRNA that has been implicated in various biological processes, including inflammatory response, autophagy, and neuronal development. It has been shown to down-regulate TRAF3 and suppress the MKK3-p38 pathway in acute pancreatitis inflammatory disease [PMC9960688]. MIR92B is predicted to reside within the Cia10 interval on rat chromosome 2 [PMC3339715]. It has been found to negatively modulate the expression of EZH2, a histone-lysine N-methyltransferase that can influence autophagy [PMC8000899]. MIR92B has also been implicated in the development of intermediate cortical progenitors in the embryonic mouse brain [PMC5764268]. In addition, MIR92B has been shown to be involved in heart development and overall body patterning in zebrafish embryos [PMC9837005]. In cancer research, MIR92B expression has been found to be dysregulated in various malignancies and is associated with prognosis [PMC3569899] [PMC6368411]. Furthermore, MIR92B expression is inversely correlated with EZH2 expression in breast cancer cells and can influence autophagy processes [PMC6952790]. In PCOS (polycystic ovary syndrome), differential expression of miR-92a and MIR92B has been observed in the ovary [PMC7199502]. Overall, MIR92B plays a crucial role in various biological processes and may have potential implications for disease development.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGGGCCCCGGGCGGGCGGGAGGGACGGGACGCGGUGCAGUGUUGUUUUUUCCCCCGCCAAUAUUGCACUCGUCCCGGCCUCCGGCCCCCCCGGCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes miRNA
Publications