Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Anas zonorhyncha (Eastern spot-billed duck) miRNA (ENSAZOG00000012166.1) secondary structure diagram

Anas zonorhyncha (Eastern spot-billed duck) miRNA (ENSAZOG00000012166.1) URS000075B9D3_75864

Automated summary: This pre miRNA sequence is 83 nucleotides long and is found in Anas zonorhyncha. Annotated by 1 database (Ensembl). Described in 1 paper. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-15, RF00455). Anas zonorhyncha (Eastern spot-billed duck) miRNA (ENSAZOG00000012166.1) sequence is a product of ENSAZOG00000012166.1 gene. Found in the eastern spot-billed duck reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CCUUGGCAUAACGUAGCAGCACAUAAUGGUUUGUGGGUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 78 other species

    1. Accipiter nisus (Eurasian sparrowhawk) microRNA 15a (ENSANIG00000008486.1)
    2. Anas platyrhynchos (mallard) microRNA 15a (ENSAPLG00020001240.1)
    3. Anas platyrhynchos platyrhynchos (common mallard) microRNA 15a (ENSAPLG00000000117.2)
    4. Anser brachyrhynchus (pink-footed goose) miRNA (ENSABRG00000005712.1)
    5. Anser cygnoides miRNA (ENSACDG00005018110.1)
    6. Apteryx haastii (Great spotted kiwi) miRNA (ENSAHAG00000013422.1)
    7. Apteryx owenii miRNA (ENSAOWG00000007845.1)
    8. Apteryx rowi (Okarito brown kiwi) miRNA (ENSARWG00000007453.1)
    9. Aquila chrysaetos chrysaetos (golden eagle) microRNA 15a (ENSACCG00020012677.1)
    10. Buteo japonicus miRNA (ENSBJAG00000006685.1)
    11. Cairina moschata domestica (muscovy Duck (domestic type)) miRNA (ENSCMMG00000001259.1)
    12. Camarhynchus parvulus (small tree finch) microRNA 15a (ENSCPVG00000003629.1)
    13. Catharus ustulatus (Swainson's thrush) miRNA (ENSCUSG00005006695.1)
    14. Chrysolophus pictus (golden pheasant) miRNA (ENSCPIG00010004650.1)
    15. Corvus moneduloides (New Caledonian crow) miRNA (ENSCMUG00000007696.1)
    16. Coturnix japonica (Japanese quail) microRNA 15a (ENSCJPG00005019797.1)
    17. Cyanistes caeruleus (blue tit) microRNA 15a (ENSCCEG00000010225.1)
    18. Cyanoderma ruficeps (rufous-capped babbler) microRNA 15a (ENSCRFG00000007297.1)
    19. Dromaius novaehollandiae miRNA (ENSDNVG00000013627.1)
    20. Chloebia gouldiae microRNA 15a (ENSEGOG00005001879.1)
    21. Falco tinnunculus miRNA (ENSFTIG00000002969.1)
    22. Ficedula albicollis microRNA 15a (ENSFALG00000015543.2)
    23. Gallus gallus (chicken) microRNA gga-mir-15a precursor
    24. Geospiza fortis microRNA 15a (ENSGFOG00000005958.1)
    25. Junco hyemalis microRNA 15a (ENSJHYG00000016166.1)
    26. Lepidothrix coronata miRNA (ENSLCOG00000007364.1)
    27. Lonchura striata domestica (Bengalese finch) miRNA (ENSLSDG00000011652.1)
    28. Malurus cyaneus samueli (superb fairywren) miRNA (ENSMCSG00000000004.1)
    29. Manacus vitellinus (golden-collared manakin) microRNA 15a (ENSMVIG00005008294.1)
    30. Meleagris gallopavo (turkey) microRNA 15a (ENSMGAG00000000025.2)
    31. Nothoprocta perdicaria miRNA (ENSNPEG00000005832.1)
    32. Numida meleagris (helmeted guineafowl) microRNA 15a (ENSNMEG00000007298.1)
    33. Parus major (Great Tit) microRNA 15a (ENSPMJG00000014940.1)
    34. Pavo cristatus (Indian peafowl) microRNA 15a (ENSPSTG00000015991.1)
    35. Serinus canaria (common canary) microRNA 15a (ENSSCAG00000013013.1)
    36. Strigops habroptila microRNA 15a (ENSSHBG00005001781.1)
    37. Struthio camelus australis miRNA (ENSSCUG00000010384.1)
    38. Taeniopygia guttata (zebra finch) microRNA 15a (ENSTGUG00000017728.2)
    39. Zonotrichia albicollis miRNA (ENSZALG00000003652.1)
    40. Zosterops lateralis melanops microRNA 15a (ENSZLMG00000010331.1)
    2D structure New