Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Cyanistes caeruleus (blue tit) microRNA 15a secondary structure diagram

Cyanistes caeruleus (blue tit) microRNA 15a URS000075B9D3_156563

Automated summary: This pre miRNA sequence is 83 nucleotides long and is found in Cyanistes caeruleus. Annotated by 1 database (Ensembl). Described in 1 paper. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-15, RF00455). Found in the blue tit reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CCUUGGCAUAACGUAGCAGCACAUAAUGGUUUGUGGGUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 39 other species

    1. Accipiter nisus microRNA 15a
    2. Anas platyrhynchos microRNA 15a
    3. Anas platyrhynchos platyrhynchos microRNA 15a
    4. Anas zonorhyncha (Eastern spot-billed duck) miRNA
    5. Anser brachyrhynchus miRNA
    6. Anser cygnoides miRNA
    7. Apteryx haastii (Great spotted kiwi) miRNA
    8. Apteryx owenii (little spotted kiwi) miRNA
    9. Apteryx rowi miRNA
    10. Aquila chrysaetos chrysaetos microRNA 15a
    11. Buteo japonicus miRNA
    12. Cairina moschata domestica miRNA
    13. Camarhynchus parvulus microRNA 15a
    14. Catharus ustulatus (Swainson's thrush) miRNA
    15. Chrysolophus pictus (golden pheasant) miRNA
    16. Corvus moneduloides (New Caledonian crow) miRNA
    17. Coturnix japonica (Japanese quail) microRNA 15a
    18. Cyanoderma ruficeps microRNA 15a
    19. Dromaius novaehollandiae (emu) miRNA
    20. Chloebia gouldiae microRNA 15a
    21. Falco tinnunculus miRNA
    22. Ficedula albicollis microRNA 15a (MIR15A)
    23. Gallus gallus (chicken) microRNA gga-mir-15a precursor
    24. Geospiza fortis microRNA 15a
    25. Junco hyemalis microRNA 15a
    26. Lepidothrix coronata (blue-crowned manakin) miRNA
    27. Lonchura striata domestica miRNA
    28. Malurus cyaneus samueli (superb fairywren) miRNA
    29. Manacus vitellinus microRNA 15a
    30. Meleagris gallopavo (turkey) microRNA 15a (MIR15A)
    31. Nothoprocta perdicaria miRNA
    32. Numida meleagris (helmeted guineafowl) microRNA 15a
    33. Parus major microRNA 15a
    34. Pavo cristatus (Indian peafowl) microRNA 15a
    35. Serinus canaria (common canary) microRNA 15a
    36. Strigops habroptila (Kakapo) microRNA 15a
    37. Struthio camelus australis (African ostrich) miRNA
    38. Taeniopygia guttata (zebra finch) microRNA 15a
    39. Zonotrichia albicollis miRNA
    40. Zosterops lateralis melanops microRNA 15a
    2D structure New