v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) GPRC5D and HEBP1 antisense RNA 1 (GPRC5D-AS1) URS000075B988_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

GPRC5D-AS1: GPRC5D-AS1 is a long non-coding RNA (lncRNA) that has been studied in relation to skeletal muscle aging and lung squamous cell carcinoma (LUSC). In a study on skeletal muscle aging, the expression levels of GPRC5D-AS1 were found to be significantly decreased during the aging process, as validated by qRT-PCR [PMC8221296]. In another study on LUSC, GPRC5D-AS1 was identified as one of the prognostic markers and was found to be downregulated in LUSC tissue [PMC8672037]. The dysregulation of GPRC5D-AS1 was also associated with the dysregulation of downstream cancer genes and the inactivation of the NOTCH signaling pathway [PMC8672037]. Furthermore, GPRC5D-AS1 showed negative correlations with immune cell infiltration and expression levels of major histocompatibility complex I and II, suggesting its potential role in reducing tumor immunogenicity [PMC8672037]. Additionally, GPRC5D-AS1 was found to be associated with N stage in LUSC [PMC8798265]. Finally, a multivariate Cox regression analysis identified GPRC5D-AS1 as one of the lncRNAs that can constitute a prognostic signature for patient survival in LUSC [PMC8520473]. Overall, these studies highlight the potential role of GPRC5D-AS1 as a prognostic marker and its involvement in skeletal muscle aging and LUSC.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAACAUACACACACCCCUGAUUCCAGAAACACAACAGGAGCUGACUCAAAAGGGAGUGUCUGGUGCAGGCAUGCAGGGAGGAAGAAUGACUCUGAGCUUGACCAUUCAACUUCGAAACUUUAACAUCAAUGGAUCAGCACACACUGGUGUACGGUCUGCUAUGCAUGCAGCCCUGUGCUAGGCAAAAGAAGUAUCAGACCAGGAACUGACAGCCUCACUGCAACAGGAAGAGAGGCUUCACACAAUAAGCGUUUCAUUCAACCAGGCUGGACCUGUGCUUAUUGAGUUGAACAUCACUGAGCACAAAAUGCAAGCCAGACACCAUAAGAGCUGUAAGGAUGAUAAAGAUGUCUUUCUACCCUCGAGAGCUCUAAGUGUGGUCAGGAGAGAAACACAUGCAAAGAUUAUGCUGGCUGGAAGGAAAUGCUGGAAUGAAGGUGGAAGCAUUCUAUUCAUCUAAAAGCACCGGUAAUUAACGAUGCUAAUAAAUGUAUAAUCCCUUUGUAAACAUCUCUUCACAAGGUCAUAAAGAAGGAAGACUGAAUGAAGGACGCCAGGCUUUCAUUUUAGAAUUAAUUUUGUCAUUGAAUGCACUCACUGCAUUAUUUGAUAGAGUACUUUUGCAUUUGAAGUAGUACAUUUGCCUUCUACCAUCUCAUUAACAUUGCUUUCAACAGAAUCAGAAAUAACACAAACCACUGCAGGGUAAUUUUGAAUGCUCAUUUGACUAUGCAGUGACAUCAAGUGGCGAGUUGAGGAAUGAUCAUAUGCUGUGUGAGAACUCCGUGUUAAAAAUUCCAUGGAGCCAGGCUAGACACCACAUUUGGCACUUUCAGCUGUUUAGAUUUCAGAGAAUUAAAAGGAAAUGGUCACCGACCUGCCUUUGAUAGUACCCGUAUACCCCUUCCCACCAUAAGAAACCAGCGUUCCUUAGAGAAAUGGCUAAUUCUAGCUCUAGGGCAAGAAAUGCUAAGAUGUGCUCAAAACAUCUCAUUAUACCAGCAAGCCAGGGAGCCAUCAACGACUACUGGAGCUGUGUCAAAAGGACCAACAAACCAACUUGAAGAGGCUCCCGCUGGCCAACAGUGGGGCAAUUAGAGCAUCAAUAAGAAUAAUAUCUGUAACAAACUGAAACGUAUCAAAUAUGUUUAAAUUCAUAUGUUUAUAAUUACACUCAAAAAACGAAGAUGCAGACCACUUUACCUUGAGGAUGUUACAGAAUGAAAUUAUCAUUCUGAAAACUGGUAAAUAAAGAGAAGGUAUCAAGUAAGCAUGUAUCUGGCUUUUUCUAUAUGAAAUAAAGGAAGCCAAAUAGUAAACGAGGGGAAGUUUCUCUUUACUGAAAUAUUGCAGGUAAUAAAAGAAGAAGGAGAAACAGAGAACAUUAUCGUUUUAUGGCCUCUAAUGGAACAAGACAUCUAGGCAAUGAUGAACUAUGGUCACCAACAUCACUCAAUCAGGGACAAUCAGACACUGUGGGCCCCUGAAGGAAGUAAACACCACCACGUAGGAAAUAUUCUCACCAAAACUUCAAAAACUUGAAUCUGAUCUAGUCUUUAGUUUCAACUACUAAUUUACAGGCAAUACGGGGCUCAGAGGGAUGUGGUAAAAUGUCACGGAAAUAUAAUCAGCAAAAUCCAGUACAGAUAAUAAGAAGACAAAUGAUCCACAGAUGGAAAGGAAGAAUGUAAAGUUGUGUUGGUAAAGAAAUUCACAGAUUAAUAAAAGCUUAAAAAUGUACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications