Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) microRNA mmu-mir-142a precursor URS000075B92A_10090

Automated summary: This pre miRNA sequence is 64 nucleotides long and is found in Mus musculus. Annotated by 6 databases (RefSeq, MGI, Ensembl, miRBase, Ensembl/GENCODE, ENA). Described in 44 papers. Mus musculus (house mouse) microRNA mmu-mir-142a precursor sequence is a product of mmu-mir-142a precursor, mir-142a precursor, mir-142a, Mir142, mir-142a precurso genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    ACCCAUAAAGUAGAAAGCACUACUAACAGCACUGGAGGGUGUAGUGUUUCCUACUUUAUGGAUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 17 other species

    1. Cavia aperea (Brazilian guinea pig) microRNA 142
    2. Cavia porcellus cpo-mir-142
    3. Chinchilla lanigera (Long-tailed chinchilla) microRNA 142
    4. Cricetulus griseus (Chinese hamster) microRNA 142
    5. Dipodomys ordii microRNA 142 (Mir142)
    6. Equus caballus (horse) microRNA eca-mir-142 precursor
    7. Fukomys damarensis (Damara mole rat) miRNA
    8. Heterocephalus glaber microRNA 142
    9. Ictidomys tridecemlineatus microRNA 142
    10. Jaculus jaculus microRNA 142 (Mir142)
    11. Mesocricetus auratus (Golden Hamster) miRNA
    12. Microtus ochrogaster microRNA 142
    13. Mus caroli microRNA 142
    14. Mus pahari microRNA 142
    15. Mus spretus microRNA 142
    16. Nannospalax galili microRNA 142 (Mir142)
    17. Octodon degus (Degu) microRNA 142
    18. Ovis aries miRNA