Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Carlito syrichta (Philippine tarsier) microRNA 346 (ENSTSYG00000023311.2) secondary structure diagram

Carlito syrichta (Philippine tarsier) microRNA 346 (ENSTSYG00000023311.2) URS000075B886_1868482

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUCUCUGUGUUGGGCGUCUGUCUGCCCGCAUGCCUGCCUCUCUGUUGCUCUGAAGGAGGCAGGGGCUGGGCCUGCAGCUGCCUGGGCAGAGCGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 25 other species

  1. Aotus nancymaae (Ma's night monkey) microRNA 346 (ENSANAG00000000101.1)
  2. Callithrix jacchus mir-346 microRNA precursor family
  3. Cavia porcellus (Domestic guinea pig) mir-346 microRNA precursor family
  4. Cebus imitator (Panamanian white-faced capuchin) microRNA 346 (ENSCCAG00000013748.1)
  5. Cercocebus atys microRNA 346 (ENSCATG00000020916.1)
  6. Chlorocebus sabaeus mir-346 microRNA precursor family
  7. Colobus angolensis palliatus miRNA (ENSCANG00000006794.1)
  8. Equus caballus microRNA eca-mir-346 precursor
  9. Gorilla gorilla gorilla microRNA 346 (ENSGGOG00000033134.2)
  10. Gorilla gorilla mir-346 microRNA precursor family
  11. Homo sapiens microRNA hsa-mir-346 precursor
  12. Macaca mulatta (Rhesus monkey) mir-346 microRNA precursor family
  13. Macaca nemestrina (Pig-tailed macaque) microRNA 346 (ENSMNEG00000000109.1)
  14. Mandrillus leucophaeus (Drill) microRNA 346 (ENSMLEG00000015979.1)
  15. Microcebus murinus (gray mouse lemur) microRNA 346 (ENSMICG00000019436.3)
  16. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 346 (ENSNLEG00000022674.2)
  17. Pan paniscus (bonobo) microRNA 346 (ENSPPAG00000005182.1)
  18. Pan troglodytes ptr-mir-346 (ENSPTRG00000027649.3)
  19. Papio anubis (Olive baboon) mir-346 microRNA precursor family
  20. Pongo abelii mir-346 microRNA precursor family
  21. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-346 precursor
  22. Rhinopithecus bieti microRNA 346 (ENSRBIG00000006539.1)
  23. Rhinopithecus roxellana microRNA 346 (ENSRROG00000021730.1)
  24. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) microRNA 346 (ENSSBOG00000019439.1)
  25. Ictidomys tridecemlineatus mir-346 microRNA precursor family
2D structure Publications