Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bos taurus (cattle) microRNA bta-mir-29c precursor secondary structure diagram

Bos taurus (cattle) microRNA bta-mir-29c precursor URS000075B799_9913

Automated summary: This pre miRNA sequence is 88 nucleotides long and is found in Bos taurus. Annotated by 4 databases (Ensembl, ENA, RefSeq, miRBase). Described in 7 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-29, RF00074). Bos taurus (cattle) microRNA bta-mir-29c precursor sequence is a product of ENSBTAG00000052678.1, mir-29c precursor, 29, 29c, bta-mir-29c precursor, MIR29C, mir-29c, mir-29c precurso genes. Found in the cattle reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AUCUCUUACACAGGCUGACCGAUUUCUCCUGGUGUUCAGAGUCUGUUUUUGUCUAGCACCAUUUGAAAUCGGUUAUGAUGUAGGGGGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 180 other species

    1. Ailuropoda melanoleuca microRNA 29c (ENSAMEG00000026011.1)
    2. Aotus nancymaae miRNA (ENSANAG00000010117.1)
    3. Artibeus jamaicensis (Jamaican fruit-eating bat) microRNA aja-mir-29c precursor
    4. Balaenoptera musculus (Blue whale) miRNA (ENSBMSG00010003743.1, ENSBMSG00010003779.1)
    5. Bison bison bison miRNA (ENSBBBG00000003116.1, ENSBBBG00000013945.1)
    6. Bos grunniens (domestic yak) microRNA 29c (ENSBGRG00000010660.1)
    7. Bos indicus x Bos taurus (hybrid cattle) miRNA (ENSBIXG00000013379.1, ENSBIXG00000013406.1, ENSBIXG00005022251.1, ENSBIXG00005022399.1)
    8. Bos mutus (wild yak) miRNA (ENSBMUG00000010106.1, ENSBMUG00000010571.1, ENSBMUG00000012497.1)
    9. Camelus dromedarius microRNA 29c (ENSCDRG00005007393.1)
    10. Canis lupus dingo (dingo) miRNA (ENSCAFG00020013173.1, ENSCAFG00020013176.1)
    11. Canis lupus familiaris (dog) miRNA (multiple genes)
    12. Capra hircus miRNA (ENSCHIG00000002482.1)
    13. Carlito syrichta miRNA (ENSTSYG00000020110.2)
    14. Cavia aperea microRNA 29c (ENSCAPG00000001803.1)
    15. Cavia porcellus microRNA 29c (ENSCPOG00000017334.3)
    16. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000017210.1)
    17. Chinchilla lanigera (Long-tailed chinchilla) microRNA 29c (ENSCLAG00000020885.1)
    18. Colobus angolensis palliatus microRNA 29c (ENSCANG00000016852.1)
    19. Cricetulus griseus (Chinese hamster) miRNA (ENSCGRG00000022209.1, ENSCGRG00001005697.1)
    20. Dasypus novemcinctus (nine-banded armadillo) microRNA 29c (ENSDNOG00000026924.1)
    21. Delphinapterus leucas (beluga whale) miRNA (ENSDLEG00000005678.1, ENSDLEG00000005719.1)
    22. Dipodomys ordii microRNA 29c (ENSDORG00000026092.1)
    23. Equus asinus asinus (donkey) miRNA (ENSEASG00005002631.1, ENSEASG00005002634.1)
    24. Equus caballus microRNA eca-mir-29c precursor
    25. Felis catus (domestic cat) miRNA (ENSFCAG00000044964.1, ENSFCAG00000046721.1)
    26. Fukomys damarensis (Damara mole rat) miRNA (ENSFDAG00000002531.1)
    27. Gorilla gorilla gorilla microRNA 29c (ENSGGOG00000031690.2)
    28. Homo sapiens (human) microRNA hsa-mir-29c precursor
    29. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) microRNA 29c (ENSSTOG00000016626.1)
    30. Jaculus jaculus (Lesser Egyptian jerboa) microRNA 29c (ENSJJAG00000003809.1)
    31. Loxodonta africana (African savanna elephant) microRNA 29c (ENSLAFG00000025260.1)
    32. Lynx canadensis miRNA (ENSLCNG00005017309.1, ENSLCNG00005017441.1)
    33. Macaca fascicularis (Crab-eating macaque) miRNA
    34. Macaca mulatta microRNA mml-mir-29c precursor
    35. Macaca nemestrina miRNA (ENSMNEG00000004534.1)
    36. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000013134.1)
    37. Marmota marmota marmota (Alpine marmot) microRNA 29c (ENSMMMG00000001674.1)
    38. Mesocricetus auratus miRNA (ENSMAUG00000006241.1)
    39. Microcebus murinus (gray mouse lemur) miRNA (ENSMICG00000019408.3)
    40. Microtus ochrogaster (vole) microRNA 29c (ENSMOCG00000004115.1)
    41. Monodon monoceros (narwhal) miRNA (ENSMMNG00015017572.1, ENSMMNG00015017675.1)
    42. Moschus moschiferus miRNA (ENSMMSG00000008929.1)
    43. Mus caroli (Ryukyu mouse) microRNA 29c (MGP_CAROLIEiJ_G0007005.1)
    44. Mus musculus microRNA mmu-mir-29c precursor
    45. Mus pahari (Shrew mouse) microRNA 29c (MGP_PahariEiJ_G0007533.1)
    46. Mus spicilegus miRNA (ENSMSIG00000026212.1)
    47. Mus spretus microRNA 29c (MGP_SPRETEiJ_G0007343.1)
    48. Mustela putorius furo (Domestic ferret) miRNA (ENSMPUG00000021454.1, ENSMPUG00000022122.1)
    49. Myotis lucifugus microRNA 29c (ENSMLUG00000022784.1)
    50. Nannospalax galili miRNA (ENSNGAG00000003490.1)
    51. Nomascus leucogenys miRNA (ENSNLEG00000022465.2)
    52. Octodon degus (Degu) microRNA 29c (ENSODEG00000021779.1)
    53. Otolemur garnettii miRNA (ENSOGAG00000017302.1)
    54. Ovis aries (sheep) miRNA (multiple genes)
    55. Pan paniscus miRNA (ENSPPAG00000004530.1)
    56. Panthera leo miRNA (ENSPLOG00000017388.1, ENSPLOG00000021043.1)
    57. Panthera pardus miRNA (multiple genes)
    58. Panthera tigris altaica (Tiger) miRNA (ENSPTIG00000003829.1, ENSPTIG00000003831.1)
    59. Pan troglodytes (chimpanzee) ptr-mir-29c (ENSPTRG00000027792.2)
    60. Papio anubis miRNA (ENSPANG00000005105.2)
    61. Phocoena sinus (vaquita) miRNA (ENSPSNG00000013044.1, ENSPSNG00000013137.1)
    62. Physeter catodon microRNA 29c (ENSPCTG00005010319.1)
    63. Pongo abelii microRNA 29c (ENSPPYG00000021146.1)
    64. Pongo pygmaeus microRNA ppy-mir-29c precursor
    65. Prolemur simus (greater bamboo lemur) microRNA 29c (ENSPSMG00000015524.1)
    66. Propithecus coquereli miRNA (ENSPCOG00000003007.1)
    67. Pteropus vampyrus microRNA 29c (ENSPVAG00000025762.1)
    68. Rattus norvegicus microRNA rno-mir-29c precursor (rno-mir-29c-1, rno-mir-29c-2)
    69. Rhinolophus ferrumequinum microRNA 29c (ENSRFEG00010018779.1)
    70. Rhinopithecus bieti miRNA (ENSRBIG00000000900.1)
    71. Rhinopithecus roxellana microRNA 29c (ENSRROG00000001542.1)
    72. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000003488.1)
    73. Sciurus vulgaris (Eurasian red squirrel) miRNA (ENSSVLG00005021116.1)
    74. Spermophilus dauricus miRNA (ENSSDAG00000015338.1)
    75. Suricata suricatta (meerkat) miRNA (ENSSSUG00005006604.1)
    76. Sus scrofa microRNA ssc-mir-29c precursor
    77. Tupaia belangeri microRNA 29c (ENSTBEG00000017861.1)
    78. Tursiops truncatus miRNA (ENSTTRG00000022264.1, ENSTTRG00000022892.1)
    79. Urocitellus parryii (Arctic ground squirrel) microRNA 29c (ENSUPAG00010016332.1)
    80. Vicugna pacos miRNA (ENSVPAG00000016480.1)
    81. Zalophus californianus (california sea lion) miRNA (ENSZCAG00015014128.1)
    2D structure New