Automated summary: This pre miRNA sequence is 83 nucleotides long and is found in Danio rerio. Annotated by 5 databases (miRBase, Rfam, ENA, Ensembl, RefSeq). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-218, RF00255). Danio rerio (zebrafish) microRNA dre-mir-218a precursor (dre-mir-218a-1) sequence is a product of dre-mir-218a-1 precursor, mir-218a-1, ENSDARG00000081745.2, 218 microRNA precursor family, mir-218 microRNA precursor family, mir-218a-1 precursor, 218 microRNA precursor famil, mir218a-1, mir-218a-1 precurso genes. Found in the zebrafish reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
CAGCUGUCUCUUGUGCUUGAUCUAACCAUGUGCCGCCGCCUACACAAGCCUCACAUGGUUCCGUCAAGCACCAGGGACCGCUG
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.