Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3666 URS000075B762_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3666: Hsa-mir-3666 is a microRNA that has been identified as a tumor suppressor [PMC8965134]. In a study, it was found that hsa-mir-3666, along with hsa-miR-130a-3p, hsa-miR-130b-3p, hsa-miR-519b-3p, and hsa-miR-519a-3p, exhibited tumor suppressor activity [PMC8965134]. Another analysis revealed that hsa-mir-3666 and hsa-miR-130b-3p downregulated the expression of CEP55 and DYNLL2 genes [PMC7844508]. Additionally, hsa-miR-15b-5p and hsa-miR6838–5p downregulated CEP55 and PPP2R1B genes, while hsa-miR195–5p downregulated PPP2R1B and DYNLL2 genes [PMC7844508]. In miRWALK analysis, it was found that 16 miRNAs including hsa-mir3666 were associated with the upregulation of 8 genes [PMC9478394]. HSA-MIR3666 has been assigned the name pred-MIR222 in miRNA database miRBase [PMC2886071]. In a ceRNA network study, HSA-MIR3666 was identified as one of the miRNAs involved along with other lncRNAs and mRNAs in regulating gene expression in cancer cells [PMC9399504].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGUGCAAGUGUAGAUGCCGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications