Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4279 precursor URS000075B6EF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4279: Hsa-mir-4279 is a 16 nucleotides-long sequence that is unlikely to correspond to a real microRNA [PMC8201247]. It has been found to be expressed in urinary extracellular vesicles of diabetic patients with macroalbumin [PMC8527307]. Hsa-mir-4279 is one of the CoV-tar-miRNAs that target the 3ʹUTR of the PSMB8 mRNA [PMC8527307]. It has also been identified as one of the potential target miRNAs for the SOCS3 gene [PMC8527307]. Hsa-mir-4279 has been associated with diabetes and is considered as a potential predictive marker for hepatocellular carcinoma recurrence [PMC8527307] [PMC5770356]. In addition, hsa-mir-4279 has been included in a list of miRNAs predicted to target the 3ʹUTR of the viral genome in pancreatic cancer [PMC7962059]. However, it should be noted that hsa-mir-4279 is not included in another list of miRNAs excluded from further analysis in pancreatic cancer research [PMC8107736]. Overall, hsa-mir-4279 appears to have potential roles in diabetes, hepatocellular carcinoma recurrence, and pancreatic cancer.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCUCUGUGGAGCUGAGGAGCAGAUUCUCUCUCUCUCCUCCCGGCUUCACCUCCUGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications