Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Apteryx rowi (Okarito brown kiwi) miRNA secondary structure diagram

Apteryx rowi (Okarito brown kiwi) miRNA URS000075B6CC_308060

Automated summary: This pre miRNA sequence is 87 nucleotides long and is found in Apteryx rowi. Annotated by 1 database (Ensembl). Described in 1 paper. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-30, RF00131). Found in the okarito brown kiwi reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CUAACUUUUAGUUCCUGUAAACAUCCUACACUCAGCUAUAACAAGUGGUAGGGCUGGGGGGUGGAUGUUUACUUCAACUGACUUGGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 12 other species

    1. Anas platyrhynchos microRNA 30b
    2. Anas platyrhynchos platyrhynchos microRNA 30b
    3. Anas zonorhyncha (Eastern spot-billed duck) miRNA
    4. Anser brachyrhynchus miRNA
    5. Anser cygnoides miRNA
    6. Apteryx haastii (Great spotted kiwi) miRNA
    7. Apteryx owenii (little spotted kiwi) miRNA
    8. Cairina moschata domestica miRNA
    9. Chrysolophus pictus (golden pheasant) miRNA
    10. Dromaius novaehollandiae (emu) miRNA
    11. Gallus gallus (chicken) microRNA gga-mir-30b precursor
    12. Meleagris gallopavo (turkey) miRNA
    13. Phasianus colchicus microRNA 30b
    2D structure New