Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-3657 precursor URS000075B6BC_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3657: Hsa-mir-3657 is identified as a candidate target miRNA for CTD-2357A8.3 [PMC6876322]. The expression levels of hsa-mir-3657 were found to be downregulated in SW620-Smad4 cells [PMC6235008]. The downregulation of TFAP2A-AS1 did not significantly alter the expression of hsa-mir-3657 [PMC8565027]. DIANA was used to predict miRNA candidates downstream of TFAP2A-AS1, and hsa-mir-3657 was identified as one of the 11 miRNAs screened out [PMC8565027].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUGUCCCAUAAUUAAAUAAUGAAAUCUGAAAUCACCAAUAAUGGGACACUAAUGUGAUUAAUGUUGUUGUGUCCCAUUAUUGGUGAUUUCAGAUUUCAUAUAUGAUUAAGGACAUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications