Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-555 URS000075B6A9_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-555: Hsa-mir-555 is a microRNA that has not been identified in certain cancers, including hsa-miR-27a, hsa-miR-6727-5p, hsa-miR-597-5p, hsa-miR-592, hsa-miR-624-5p, hsa-mir-555, hsa-miR-376a-2-5p, hsa-miR-6824-3p, hsa-miR1255b2 3p , has not been identified in the queried cancers [PMC9293659]. It is one of the 20 miRNAs that are up-regulated in good prognosis and are considered hub miRNAs [PMC8004706]. Hsa-mir555 is one of the 20 different human mirVANA miRNA Mimics that were purchased for a study [PMC3992492]. HSA mir555 is one of the 10 highest-ranking candidate miRNAs and has predicted interactions with 190 target mRNAs [PMC6948356]. It has not been researched before along with HSA mir1286 and HSA mir558 [PMC6948356]. In LADA patients, the expression pattern of HSA mir555 coincides with the trend observed in miRNA transcriptomic profiling [PMC6683294]. The expression of HSA mir555 shows a trend of positive correlation with GAD antibody titer but lacks statistical significance due to insufficient LADA samples [PMC6683294]. In an independent batch of samples for validation purposes through qRT PCR analysis using a miDETECT TractTM miRNA qRT PCR Starter Kit (RiboBio), two consistently up-regulated microRNAs (HSA miRNA93 5p and HSA mir555) were obtained along with eight consistently down-regulated microRNAs [PMC6683294].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGGUAAGCUGAACCUCUGAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes ptr-miR-555
Publications