v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus spicilegus (steppe mouse) microRNA 193a (ENSMSIG00000008610.1) URS000075B5F0_10103

Automated summary: This miRNA sequence is 66 nucleotides long and is found in Mus spicilegus. Annotated by 1 database (Ensembl). Matches 1 Rfam family (mir-193, RF01895). Mus spicilegus (steppe mouse) microRNA 193a (ENSMSIG00000008610.1) sequence is a product of ENSMSIG00000008610.1 gene. Found in the Mus spicilegus reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    GAGAGCUGGGUCUUUGCGGGCAAGAUGAGAGUGUCAGUUCAACUGGCCUACAAAGUCCCAGUCCUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 3 other species

    1. Mus caroli microRNA 193a (MGP_CAROLIEiJ_G0007144.1)
    2. Mus musculus microRNA mmu-mir-193a precursor
    3. Mus spretus microRNA 193a (MGP_SPRETEiJ_G0007486.1)