Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1244 URS000075B58F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-miR-1244: Hsa-mir-1244 is a microRNA that has been identified as part of a network of interacting miRNAs, including hsa-mir-4533, hsa-mir-548ac, hsa-mir-548i, hsa-mir-5585-3p, hsa-mir-6750-3p, hsa-mir-200c-3p, hsa-mir-1273g-3p, hsa-mir-4789-3p, and hsa-miR766 [PMC8256614]. These miRNAs have been selected based on their high degree of interaction within the network [PMC8256614]. In the context of obesity and atherosclerosis, it has been found that PCSK9 may have an impact on the release of extracellular vesicles (EVs) derived from various components involved in atherosclerosis [PMC8782054]. These EVs carry specific miRNAs linked to atherosclerosis such as hsa-miR362, hsa-miR150, hsa-miR1244, hsa-miR520b3p, and hasmiR638 [PMC8782054]. These miRNAs have targeted genes such as LDLR (low-density lipoprotein receptor), TLR4 (Toll-like receptor 4), and ESR1 (estrogen receptor 1) [PMC8782054].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGUAGUUGGUUUGUAUGAGAUGGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Publications