Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 1323 (ENSNLEG00000019811.2)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 1323 (ENSNLEG00000019811.2) URS000075B58C_61853

73 nucleotides
2 databases (Ensembl, Rfam)
Found in 6 other species
157 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

ACUGAGGUCCUCAAAACUGAGGGGCAUUUUCUGUGGUUUGAAAGGAAAGUGCACCCAGUUUUGGGGAUGUCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

Gorilla gorilla gorilla microRNA 1323 (ENSGGOG00000029910.2)
Homo sapiens microRNA hsa-mir-1323 precursor
Pan paniscus (bonobo) microRNA 1323 (ENSPPAG00000005235.1)
Pan troglodytes ptr-mir-1323 (ENSPTRG00000034960.2)
Pongo abelii microRNA 1323 (ENSPPYG00000024281.2)
Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-1323 precursor

2D structure

Publications