v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) MIR4300 host gene (MIR4300HG) URS000075B57A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR4300HG: MIR4300HG is a long non-coding RNA (lncRNA) gene that has been studied in relation to various conditions, including adolescent idiopathic scoliosis (AIS) and postoperative nausea and vomiting (PONV) [PMC9180299] [PMC7491086]. Studies have shown that a functional variant, rs35333564, located in MIR4300HG is associated with the progression of AIS in both Japanese and Chinese populations [PMC8117547]. Methylation of MIR4300HG has also been linked to the progression of AIS [PMC7309379]. Additionally, MIR4300HG has been associated with reduced incidence of PONV in Japanese patients [PMC7491086]. The gene may regulate the development of PONV through the estrogen signaling pathway [PMC7491086]. Furthermore, MIR4300HG has been found to be associated with scoliosis curve progression and may influence spinal curves during the adolescent growth period [PMC8117547]. However, the biological function of MIR4300HG remains largely unknown [PMC7491086] and further studies are needed to fully understand its role in these conditions.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCCCGUGCCUCUCCCUCCACACCUCCCCGCAACUGAGGGAGCCGGCUCCGGCCUCGGCCAGCCCAGAAAGGGGCUCACACAGUGCAGGGCCGGGCUGAAGGGCUCCUUAAGGGCGGCCAGAGUUGGCGCCAAGGCUGAGGAGGUGCCCAGAGCGAGCGAGGGCUGCCAGGGCUGCUAGCAGGCUGUCACCUCUCAAUAGCAGUUUUGUAUAUGGGAUCUAGCCCCUCCCUAAGAGGUUGAUUCUAAGGAAGCCAACAGCCGUGUUGUGAGUACCCAAUGGAAAGUCUGUUGUGGCAGAAAACUGAUGUCUCCAGCCAACAGCACUGAGGCCCUGAGACCUGCCAACUGUCAUGAUCUUCCGAUGCCUGGACACAGAAAGAGCAGUGGAAGGGGUCGUUGCAUGAGCAAAGACAAAGAGUGGGACACUGACUGUUACAUCUCAAGGAGAAGGAUUGCCAGAUCAAAAGUCUUGCAGUUAACCAGGCGUGGUGGCAGAUACCUGUAAUCCCAGCUAUUCGGGAGGCUGAGGCAGGAGAAUCGCUUGUACCCGGGAGGCAGAGGUUGCAGUGAGCUGAGACCGCGCCAUUGACUCCUGCCUGAUGACAAGAGAGAAUCUACGUCUCAACAACAACAACACGCUUGGGCACUGUAUUAACUCCAUAAUCGGUUUAUUCAUAAUGCUGCAUCAUCCAACCAUCAUCCAACCUAUUUAUCAUUCACAAUGCCACCUGUGAAUACUGGCUUCCAUUGACUCUUUCAAGAAUUGCUACUGGGCCUCACCAAUGUUGACCACAAAUGCAAGUCAUACUGAGAGCCUCUGUGCUCUUUCCCCUGUGGACAAUAACUACCAUUUCAUCCUGGACACCCAUUGUUUGCCUGGACCACACCUUGUUAUGACCAUAACCCUCAGUCAGACUCAACCUUCCUUCAAGAUCUGCAGAUCUAAAUUUUAUUGGGAACAGCUAGUUUGACAAGCAUAGACCAGAUGUCCAGUUGUCAUUCAUUCAGCAGGAGCAGCAAGAUUCAAUCAUGUUUUUAUUAUAUUAUUUCCUGAAACUUGUGGCUGUAACAAUGAAGUUUGAGGAUUGGUCUGUGUAAGUAUGGCAGAAGUGAUGUUAAGUCGCUUAUGAGAUUAGGGUAUAAAAGACUAAGGCUUCCAUGCUUCCAUCUUGGUCUCUGUCUCUCAGAGAACAGUCAUGUGAAUGAUUCUUCUUGAAAGUAAAUCUUCCAGCCCCAGUCCAGUAUUCAAAUGAUCCAGCAACAUUGCAACUUAUGAGAGACCUUGAGCCAUCCAGGUAACAUGCUUCCAAAUCCUGACCCUUAAAACCUGUAAAAUAAUAAAUGUGGUUUUAAACUCUUAAGUAAUUUGUUACAUAGUAAUAAAUAGCUAAUACACCGUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications