Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 2256 (LINC02256) URS000075B551_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC02256: LINC02256 is a long intergenic non-protein coding RNA (lncRNA) that has been associated with immune infiltration in non-small cell lung cancer (NSCLC) patients [PMC9712323]. It is also implicated in breast cancer, where high expression levels of LINC02256 are associated with a longer recurrence-free survival (RFS) time [PMC7603345]. LINC02256 is located on chromosome 15q13.3 and has two transcripts [PMC7603345]. In NSCLC, a set of seven lncRNAs, including LINC02256, has been identified as prognostic immune lncRNAs and correlated with overall survival (OS) [PMC7057423]. Furthermore, LINC02256 has been identified as an immune infiltration-associated lncRNA that can serve as a biomarker for immunotherapy [PMC8239301]. In bladder cancer cell lines, the expression level of LINC02256 was found to be significantly higher compared to normal cells [PMC10090514]. The expression level of LINC02256 can be quantified using the 2−ΔΔCq method and is included in an lncRNA-based prognostic signature for NSCLC patients [PMC7057423] and bladder cancer cell lines [PMC10090514]. References: - PMC9712323 - PMC7603345 - PMC7057423 - PMC8239301 - PMC10090514

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCGCCGCUGCGGCUGCUGCGCGGUGAGGUCGUGACAAGUCACAGCUAACUUGCCCUCCGCGCCAUUCCACGCCACCAGGAAGCGCAGCCGGUGCCUCUCGGCAUCGGCGAAGAGGCCUUGCCGGACCGGCGCCCAGCCCUCCAGGCUGUCGAGCUGCUCGUCCUCCAUGGCCGUCGGCGGCAGCGGCCCUAGGACUCGGCGGGCGCGGGCCUGACCUCGUCGCACUGCCUGUCAGGGGACAGUCCCAGGCAUAACUGAAGGUGAAAGGACAGAAUCACCGUGUGUUACUGGCACAGAUGCAUCGGCUAGUGAAGAAAGAAGACAUUCAAACUAGUCCCGCUCUGUCGCCCAGUCUGGAGUGCAGCAGCGCCAUCAUAGCUCACUGCCACCUAGAAGCCGGGGUGAAGCAAUCCUCCUCCAUCAGCCUUCAGAGUAGCUGGGACUACCUGCGCGGCCCACCACAGCCGGCUAAUCUUUGUGGUUUUUCUUUUGUUUUCCGUUCUGGGUUUCCGUCGGGCGCAGUGGCUCAGGCCUGCAAUCCCAGCACUUUGGAAGGCAGAGGUGGGCGGAUCACCCGAGGUCGGAGACCAGCCUGACCAACAUGAAGAAAUCCCGUCUCUACUAAAAAAAAGAAAAAAACUACAAAAUUAGCCGGAUAUGGUGGCUCAUGCCUGUAAUCCCAGCUACUAGGGAGGCCCAGGCAGGAGAAUCACCUAAAUCCGGGAGGCCGAGGUUGCGGUGGGCAAAGAUCACACCAUUGCACUCCAGCCUGGACAACAAGGGUGAAACUCCGUCUCAAAACAGAGACCGGGUUUCACCAUGUUGCCCAGGCGGUCUGGAACUCCUAGGCUCAAGCGAUCUGCCACACUCGGCCUUCCAAAGUCCUGGGAUCACAAGGGGGAGGCACCACGCCAGGCAGAUCUAUUCCUUUCUGGUUACUAAAUUGGACCGGGGGCGCGGUGGCUCACGCCUGCAAUCCCAGCACCCAGGGAGGCGGAGGCGGGCGUAUCACUCGAGGUCAGGAGCUCGAGAUCAGCCUGACCAACACGGAGAAACCCCGUCUGUACCAAAAAAAUAAAACCAAAAUUAGCUGGCAUGGUGGCUCAUGCCUGCAAUCCCAGACACUCAGGAGGCUGAGGCAGGAGAACCACCUAAACCCGGGAGGUGGAGGCCGCGGUGAGUCGAGACCACGCCACUGCACUCCAGCCUGCAAAACGAGCGAAACUCCACUCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications