Xenopus tropicalis (tropical clawed frog) xtr-miR-181b URS000075B51A_8364

• 22 nucleotides
• 2 databases (miRBase, RefSeq)
• Found in 15 other species
• 16 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

AACAUUCAUUGCUGUCGGUGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

1. Anolis carolinensis aca-miR-181b
2. Danio rerio dre-miR-181b-5p
3. Daubentonia madagascariensis (aye-aye) dma-miR-181b
4. Gallus gallus gga-miR-181b-5p
5. Ictalurus punctatus (channel catfish) ipu-miR-181b
6. Mus musculus Mus_musculus piRNA piR-mmu-5864177
7. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-181b
8. Oreochromis niloticus (Nile tilapia) oni-miR-181d
9. Otolemur garnettii (small-eared galago) oga-miR-181b
10. Papio hamadryas pha-miR-181b
11. Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-62932
12. Salmo salar ssa-miR-181c-5p
13. Takifugu rubripes fru-miR-181b
14. Tetraodon nigroviridis tni-miR-181b
15. Tor tambroides miR-181b-5p

Publications Download

• FASTA
• JSON