Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Anolis carolinensis (green anole) aca-miR-181b URS000075B51A_28377

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACAUUCAUUGCUGUCGGUGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Danio rerio dre-miR-181b-5p
  2. Daubentonia madagascariensis (aye-aye) dma-miR-181b
  3. Gallus gallus gga-miR-181b-5p
  4. Ictalurus punctatus (channel catfish) ipu-miR-181b
  5. Mus musculus Mus_musculus piRNA piR-mmu-5864177
  6. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-181b
  7. Oreochromis niloticus (Nile tilapia) oni-miR-181d
  8. Otolemur garnettii (small-eared galago) oga-miR-181b
  9. Papio hamadryas pha-miR-181b
  10. Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-62932
  11. Salmo salar ssa-miR-181c-5p
  12. Takifugu rubripes fru-miR-181b
  13. Tetraodon nigroviridis tni-miR-181b
  14. Tor tambroides miR-181b-5p
  15. Xenopus tropicalis xtr-miR-181b
Publications