Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Tetraodon nigroviridis (spotted green pufferfish) tni-miR-181b URS000075B51A_99883

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Tetraodon nigroviridis. Annotated by 1 database (miRBase). Found in the Tetraodon nigroviridis reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AACAUUCAUUGCUGUCGGUGGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 15 other species

    1. Anolis carolinensis aca-miR-181b
    2. Danio rerio (zebrafish) dre-miR-181b-5p
    3. Daubentonia madagascariensis (aye-aye) dma-miR-181b
    4. Gallus gallus (chicken) gga-miR-181b-5p
    5. Ictalurus punctatus ipu-miR-181b
    6. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-5864177
    7. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-181b
    8. Oreochromis niloticus oni-miR-181d
    9. Otolemur garnettii oga-miR-181b
    10. Papio hamadryas (hamadryas baboon) pha-miR-181b
    11. Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-62932
    12. Salmo salar ssa-miR-181c-5p
    13. Takifugu rubripes (torafugu) fru-miR-181b
    14. Tor tambroides (Thai mahseer) miR-181b-5p
    15. Xenopus tropicalis (tropical clawed frog) xtr-miR-181b
    Publications