Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-181b-5p URS000075B51A_9031

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Gallus gallus. Annotated by 3 databases (ENA, miRBase, RefSeq). Gallus gallus (chicken) gga-miR-181b-5p sequence is a product of gga-miR-181b, miR-181, miR-181b, MIR181B1, MIR181B2, gga-miR-181b-5p, miR-181b-5p genes. Found in the chicken reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AACAUUCAUUGCUGUCGGUGGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 15 other species

    1. Anolis carolinensis aca-miR-181b
    2. Danio rerio dre-miR-181b-5p
    3. Daubentonia madagascariensis (aye-aye) dma-miR-181b
    4. Ictalurus punctatus (channel catfish) ipu-miR-181b
    5. Mus musculus Mus_musculus piRNA piR-mmu-5864177
    6. Nomascus leucogenys nle-miR-181b
    7. Oreochromis niloticus oni-miR-181d
    8. Otolemur garnettii (small-eared galago) oga-miR-181e
    9. Papio hamadryas (hamadryas baboon) pha-miR-181b
    10. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-62932
    11. Salmo salar (Atlantic salmon) ssa-miR-181c-5p
    12. Takifugu rubripes (torafugu) fru-miR-181b
    13. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-181b
    14. Tor tambroides (Thai mahseer) miR-181b-5p
    15. Xenopus tropicalis xtr-miR-181b
    Publications New