Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1257 URS000075B4B8_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1257: Hsa-mir-1257 is a microRNA that has been found to be downregulated in HIV-infected breast milk compared to uninfected milk [PMC7395778]. It is also included in the hsa_circ_0000497 ceRNA network, along with other miRNAs and mRNAs [PMC9092689]. Hsa-mir-1257, along with hsa-miR-100-3p, has been implicated in the anti-colorectal cancer (CRC) mechanism of GA-Me [PMC9093067]. These miRNAs were found to be expressed at significantly lower levels in CRC tissues compared to normal tissues [PMC9093067]. Hsa-mir-1257 is also one of the differentially expressed miRNAs in heart failure (HF) and cognitive impairment, along with other miRNAs such as hsa-miR-342-3p and hsa-miR-1246 [PMC8478533]. In a study on CAP-treated cells, hsa-mir-1257 was found to be downregulated [PMC8851033]. Additionally, hsa-mir-1257 has been predicted to pair with hsa_circ_0003829 along with other miRNAs such as hsa-miR-145 and hsa-miR-198 [PMC7545778]. References: [PMC7395778] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7395778/ [PMC9092689] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9092689/ [PMC9093067] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9093067/ [PMC8478533] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8478533/ [PMC8851033] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8851033/ [PMC7545778] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7545778/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGUGAAUGAUGGGUUCUGACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Publications