Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-1469 precursor URS000075B460_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR1469: MIR1469 is a microRNA that has been studied in various contexts [PMC7180315]. In a microarray analysis, the expression levels of miR-4689, miR-6076, and MIR1469 were inconsistent, but the differences were not evident [PMC7180315]. According to the ceRNA theory, LOC100302640 may act as a ceRNA and competitively bind with miR-1469 to release the suppression of SMAD6 by MIR1469, promoting osteogenesis of PDLSCs [PMC8725252]. However, further verification is needed to understand the specific mechanism of this ceRNA network [PMC8725252]. A single nucleotide polymorphism (SNP) is located in an intergenic region between LOC400456/LOC145820 and NR2F2 and MIR1469 genes [PMC4872459]. In AGE-modified BME (without TGFβ2 treatment), significant upregulations were observed in the mRNA levels of MMP2, miR4279, and MIR1469 [PMC4854921]. Similarly, cells cultured on AGE-modified BME showed significantly higher mRNA levels of CTGF, integrin αV, MMP‐2, MIR1469, and miR4279 compared to cells cultured on unmodified BME [PMC4854921]. TGFβ2 upregulates αSMA, MMP2, CTGF, integrin αV, integrin α5, integrin β1, miR4279, and MIR1469 during EMT in HLE cells [PMC4854921]. In cluster 4 of DE miRNAs analysis, MIR1202, MIR1207, MIR1243, MIR1246, MIR1307, MIR1469, MIR1915, MIR2861, MIR3130, MIR3143, MIR3178, MIR3191, MIR3196, MIR3202, MIR320A, MIR320E, MIR3613, MIR3621, MIR3665, MIR3667, MIR3679, MIR3684, MIR4261, MIR4267, MIR4280, MIR4281, MIR4330, MIR494, MIR500B, MIR514B, MIR550, MIR560, and MIRLET7A2 were upregulated [PMC8235499].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUCGGCGCGGGGCGCGGGCUCCGGGUUGGGGCGAGCCAACGCCGGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

Publications