v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Capra hircus (Goat) microRNA 125a (ENSCHIG00000009211.1, ENSCHIG00010016691.1) secondary structure diagram

Capra hircus (Goat) microRNA 125a (ENSCHIG00000009211.1, ENSCHIG00010016691.1) URS000075B3CE_9925

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGCCGGCCUCUGCGUCCCUGAGACCCUUUAACCUGUGAGGACGUCCAGGGUCACAGGUGAGGUUCUUGGGAGCCUGGCGUCCGGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Bison bison bison miRNA (ENSBBBG00000016299.1)
  2. Bos grunniens miRNA (ENSBGRG00000018620.1)
  3. Bos indicus x Bos taurus miRNA (ENSBIXG00000016957.1, ENSBIXG00005016826.1)
  4. Bos mutus (wild yak) miRNA (ENSBMUG00000010970.1)
  5. Bos taurus microRNA bta-mir-125a precursor
  6. Cervus elaphus hippelaphus ncRNA
  7. Cervus hanglu yarkandensis microRNA 125a (ENSCHYG00000001524.1)
  8. Moschus moschiferus (Siberian musk deer) microRNA 125a (ENSMMSG00000009343.1)
 2D structure Publications