Cervus hanglu yarkandensis (Yarkand deer) microRNA 125a (ENSCHYG00000001524.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cervus hanglu yarkandensis (Yarkand deer) microRNA 125a (ENSCHYG00000001524.1) URS000075B3CE_84702

86 nucleotides
1 database (Ensembl)
Found in 8 other species
114 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UGCCGGCCUCUGCGUCCCUGAGACCCUUUAACCUGUGAGGACGUCCAGGGUCACAGGUGAGGUUCUUGGGAGCCUGGCGUCCGGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

Bison bison bison miRNA (ENSBBBG00000016299.1)
Bos grunniens miRNA (ENSBGRG00000018620.1)
Bos indicus x Bos taurus miRNA (ENSBIXG00000016957.1, ENSBIXG00005016826.1)
Bos mutus (wild yak) miRNA (ENSBMUG00000010970.1)
Bos taurus microRNA bta-mir-125a precursor
Capra hircus microRNA 125a (ENSCHIG00000009211.1, ENSCHIG00010016691.1)
Cervus elaphus hippelaphus ncRNA
Moschus moschiferus (Siberian musk deer) microRNA 125a (ENSMMSG00000009343.1)

2D structure

Publications