Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Moschus moschiferus (Siberian musk deer) microRNA 125a (ENSMMSG00000009343.1) secondary structure diagram

Moschus moschiferus (Siberian musk deer) microRNA 125a (ENSMMSG00000009343.1) URS000075B3CE_68415

Automated summary: This pre miRNA sequence is 86 nucleotides long and is found in Moschus moschiferus. Annotated by 1 database (Ensembl). Described in 1 paper. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (lin-4, RF00052). Moschus moschiferus (Siberian musk deer) microRNA 125a (ENSMMSG00000009343.1) sequence is a product of ENSMMSG00000009343.1 gene. Found in the siberian musk deer reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGCCGGCCUCUGCGUCCCUGAGACCCUUUAACCUGUGAGGACGUCCAGGGUCACAGGUGAGGUUCUUGGGAGCCUGGCGUCCGGCC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    2D structure New