v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 539 (LINC00539) URS000075B2E9_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00539: LINC00539 is a long intergenic non-protein coding RNA that has been implicated in various biological processes and diseases [PMC7926392]. It has been found to be dysregulated in asbestos-related lung squamous carcinoma [PMC7926392]. LINC00539 is one of the genes identified in the LUAD expression signature model [PMC7926392]. It has also been associated with head and neck squamous cell carcinoma (HNSCC) as a protective factor [PMC9213787]. In addition, LINC00539 has been found to be co-expressed with genes such as CDKN2A, SLC1A4, and ATF3 in a network analysis [PMC9745071]. Furthermore, LINC00539 has been identified as one of the lncRNAs with reciprocal relationships with GSDME [PMC8995648]. The LINC00539/ZDHHC20 locus has also been implicated in adverse metabolic response to hydrochlorothiazide [PMC6369905]. Additionally, LINC00539 is associated with risk of brain infarction (BI) and overall survival [PMC6369905][PMC7432272]. It is positively correlated with changes in deep subcutaneous adipose tissue area and HOMA index after intervention [PMC7670623]. In lung adenocarcinoma, LINC00539 may be involved in the immune response against tumors [PMC9961609]. Overall, these findings suggest that LINC00539 plays a role in various diseases and biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GAAAGAUGCAACCUGGGCCAGAGGCCCCUGGAGGUUGUGCCUGAACCCAGACAGAUCACACAAACCUGAGCAGCCAUUAGCCGCUGUGUGGGCUCCUUUGCACUGUGGGGCUGCUCCUGGGGAUAUUUACGUUGUGAACUGGUAAAAUCUGAACUGCAGAAUAUCAAUUUCCAGACAUUCUUCCUAGAUGAUGCCGUCUGCCACGGAGACCAUGUAGAUGGAUUGAAUGGGGAUAUGAUGAGGAUGACCACCCCUGCAUUUGCUAAGUUCUUGGGAGUGGCAUCGAUCUCAGCCAUUCCACUGGAAUAGGGUCAGGAAACAAAACGUGAGGGCUCUACCAGCUGCUCAGUCUAUCCUUUCCAAUUGAGCACACUGGAACUGAGGAAGCAAAGACAGGGUGAGCCCUAACACCCUCAUCAUCACUGCUGAGCCUGCCUUGACAAGAACUCCAUUUAUCACCCGCCUCCAUAAUAGCCCAUUCUAACUAGCUGUCAUCGUGGCAUUUCAGGUUCUGCUGAUGUCAUUAUAAUGGACCUUAACUAGUGGGCUGAAGGCAAUGAGGGGAUGUGAGGAUGCAUCUUGUGAAGGACAAAAGUCAUCCUGUAAGGAUUCAUGAGACCUGAGCAGCCAGCCAGCCCUGAAAUGGUUGGAACAGGAGAAAGAAGAAGAGCUCGACAGAUACCCUGCCUGGGCUGGCAGCUAGCUGCACCACAAGCUGGCCAGCUGACAGCGGGCACAUCCCUUCAUCACCCAGUGCCUUUCUUCCCUCUUGUGAAAAUGGAGAUAUGCUGAGAAGGUUACUUCAGCUCAUCCAGAGAAAGCUUCUUCAGCUAACUAGGCUGUAGAAAGGGCCUACAGCCUAAAUUUUCAAAAACAAGUUAAUGCCAGAAUAUAAACUCCGUGAAGUAACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications