Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-6812 precursor URS000075B2E6_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR6812: MIR6812 is a microRNA that has been predicted to have binding sites with circMTND5, a circular RNA, using TargetScan and miRanda [PMC9578797]. In a study on lupus nephritis, it was found that the MIR6812 inhibitor reversed the downregulation of mitochondrial functional genes UCP2 and PGC-1α, and the upregulation of profibrotic genes COL3 and FN [PMC9578797]. The study also showed that circMTND5 localized to mitochondria and served as a sponge for MIR6812 in human kidney tissues and renal tubular cells [PMC9578797]. The interaction between circMTND5 and MIR6812 was confirmed through luciferase reporter assays [PMC9578797]. Knockdown of circMTND5 upregulated the expression of MIR6812, while overexpression of circMTND5 reversed the effects induced by hTGF-β stimulation [PMC9578797]. The expression levels of circMTND5 and MIR6812 were measured in mitochondrial fractions using qPCR [PMC9578797]. Further analysis showed that MIR6812 directly downregulated mitochondrial UCP2 by binding to its 3'UTR [PMC9578797]. The study also found that overexpression of MIR6812 increased its expression in HK-2 cells, which colocalized with COX IV in mitochondria [PMC9578797]. Overall, the findings suggest that circMTND5 may contribute to mitochondrial injury and renal fibrosis by sponging MIR6812, while MIR6812 regulates UCP2 and PGC-1α to participate in renal fibrosis in lupus nephritis [PMC9578797].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGGAUGGGGUGAGAUGGGGAGGAGCAGCCAGUCCUGUCUCACCGCUCUUCCCCUGACCCCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications