Automated summary: This pre miRNA sequence is 96 nucleotides long and is found in Saccoglossus kowalevskii. Annotated by 3 databases (ENA, RefSeq, miRBase). Matches 1 Rfam family (mir-29, RF00074). Saccoglossus kowalevskii microRNA sko-mir-29b precursor sequence is a product of Mir29b, mir-29b precurso, 29, sko-mir-29b precursor, mir-29b precursor, 29b, mir-29b genes. Found in the Saccoglossus kowalevskii reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
UGAACUCUCUGACCUUAGGAACCUGAUUUCAAACGGUGGAUAGAUUCCAUAGCAACAGUCUAGCACCAUUUGAAAUCAGUGUUCCUAGUUCAAGAA
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.