Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens let-7d stem-loop (hsa-let-7d) URS000075B243_9606

Automated summary: This pre miRNA sequence is 87 nucleotides long and is found in Homo sapiens. Annotated by 7 databases (miRBase, ENA, HGNC, GeneCards, MalaCards, Ensembl, RefSeq). Matches 1 Rfam family (let-7, RF00027). Homo sapiens let-7d stem-loop (hsa-let-7d) sequence is a product of MIRLET7D, let-7d precursor, let-7d precurso, let-7d, 7d, 7, ENSG00000199133.3, hsa-let-7d precursor genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    CCUAGGAAGAGGUAGUAGGUUGCAUAGUUUUAGGGCAGGGAUUUUGCCCACAAGGAGGUAACUAUACGACCUGCUGCCUUUCUUAGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 24 other species

    1. Ailuropoda melanoleuca (giant panda) miRNA
    2. Capra hircus (Goat) microRNA let-7d (ENSCHIG00000009434.1)
    3. Carlito syrichta (Philippine tarsier) miRNA (ENSTSYG00000020056.2)
    4. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000016907.1)
    5. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000015423.1)
    6. Erinaceus europaeus miRNA (ENSEEUG00000016103.1)
    7. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA let-7d (ENSGGOG00000032510.2)
    8. Loxodonta africana (African savanna elephant) microRNA let-7d (ENSLAFG00000024275.1)
    9. Macaca fascicularis (Crab-eating macaque) miRNA
    10. Macaca mulatta let-7d stem-loop (mml-let-7d)
    11. Macaca nemestrina miRNA (ENSMNEG00000003398.1)
    12. Mandrillus leucophaeus miRNA (ENSMLEG00000011271.1)
    13. Mustela putorius furo (Domestic ferret) miRNA (ENSMPUG00000020896.1)
    14. Myotis lucifugus (little brown bat) miRNA (ENSMLUG00000017955.1)
    15. Nomascus leucogenys microRNA let-7d (ENSNLEG00000023262.2)
    16. Otolemur garnettii (small-eared galago) miRNA (ENSOGAG00000017416.1)
    17. Ovis aries let-7d stem-loop (oar-let-7d)
    18. Pan paniscus (bonobo) microRNA let-7d (ENSPPAG00000004896.1)
    19. Pan troglodytes (chimpanzee) ptr-let-7d (ENSPTRG00000027668.3)
    20. Papio anubis miRNA (ENSPANG00000027296.2)
    21. Pongo abelii (Sumatran orangutan) miRNA
    22. Pongo pygmaeus let-7d stem-loop (ppy-let-7d)
    23. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000000274.1)
    24. Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000018574.1)
    25. Sorex araneus (European shrew) miRNA (ENSSARG00000016537.1)
    26. Tupaia belangeri (northern tree shrew) miRNA (ENSTBEG00000017843.1)
    27. Vicugna pacos (alpaca) miRNA (ENSVPAG00000016293.1, ENSVPAG00000016566.1)
    Publications New